Stem-loop sequence mdm-MIR166e

AccessionMI0023021 (change log)
DescriptionMalus domestica miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mdm-MIR166e
(35 sentences)

Stem-loop
            a    uu               u     -   -a  uug 
5' aguugaggg aaug  gucugguucgagauc uucag uga  gc   g
   ||||||||| ||||  ||||||||||||||| ||||| |||  ||   a
3' ucaacuccc uuac  cggaccaggcuuuag aaguc acu  ug   u
            c    uu               u     u   ac  uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC019868.259: 3882-3978 [-]
intergenic
Database links

Mature sequence mdm-miR166e

Accession MIMAT0025917
Sequence

71 - 

ucggaccaggcuucauucccc

 - 91

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).