Stem-loop sequence mdm-MIR166d

AccessionMI0023020 (change log)
DescriptionMalus domestica miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mdm-MIR166d
(35 sentences)

Stem-loop
      u    a        uu      cu     - cccu   -    -  u       cca          cg  ----      aaccac 
5' ggu auug ggggaaug  guuugg  cgagg c    agc uaga uc augaucu   ucucaauugg  ac    aauuuu      c
   ||| |||| ||||||||  ||||||  ||||| |    ||| |||| || |||||||   ||||||||||  ||    ||||||      a
3' uca uaac ccccuuac  cggacc  gcucc g    uug aucu ag uacuaga   agaguugacc  ug    uuaaaa      a
      u    c        uu      ag     a caau   c    u  c       --a          -a  acau      aauucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC009861.462: 128-300 [+]
intergenic
Database links

Mature sequence mdm-miR166d

Accession MIMAT0025916
Sequence

144 - 

ucggaccaggcuucauucccc

 - 164

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).