Stem-loop sequence mdm-MIR166b

AccessionMI0023018 (change log)
DescriptionMalus domestica miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mdm-MIR166b
(35 sentences)

Stem-loop
       u        cu             c     ----------c   ga 
5' guug ggggaaug  gucugguucgaga cauuc           ucu  a
   |||| ||||||||  ||||||||||||| |||||           |||  a
3' caac ccccuuac  cggaccaggcucu guaag           aga  c
       c        uu             a     ruacaaguaca   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR166b

Accession MIMAT0025914
Sequence

68 - 

ucggaccaggcuucauucccc

 - 88

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).