Stem-loop sequence mdm-MIR166a

AccessionMI0023017 (change log)
DescriptionMalus domestica miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention mdm-MIR166a
(37 sentences)

Stem-loop
   u  a        uu      cu   g   u  -u     auugaucuauaauccccuagaucaacaaccuucauauauaucuaua 
5'  ug ggggaaug  gucugg  cga gac cu  uucau                                              u
    || ||||||||  ||||||  ||| ||| ||  |||||                                              g
3'  ac ccccuuac  cggacc  gcu cug ga  aagug                                              u
   a  c        uu      ag   g   u  uu     gacuaguagagacacauacgucaacuaugugcguuguauauguaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC011683.626: 7710-7881 [+]
intergenic
Database links

Mature sequence mdm-miR166a

Accession MIMAT0025913
Sequence

148 - 

ucggaccaggcuucauucccc

 - 168

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).