Stem-loop sequence mdm-MIR164e

AccessionMI0023015 (change log)
DescriptionMalus domestica miR164e stem-loop
Gene family MIPF0000045; MIR164
Literature search

8 open access papers mention mdm-MIR164e
(39 sentences)

Stem-loop
        a    ca         c  uu         u   -au   c  k   y    uacucaauacucuuauuuuucucug 
5' gaugg gaag  gggcacgug au  cuaacucau cgc   aua ug gau uaua                         a
   ||||| ||||  ||||||||| ||  ||||||||| |||   ||| || ||| ||||                         g
3' cuacc cuuc  cccguguac ug  gauugagua gug   uau ac cua auau                         c
        c    uc         u  uu         -   acc   -  u   u    agacauuugaacauuauuaaaucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR164e

Accession MIMAT0025911
Sequence

3 - 

uggagaagcagggcacgugca

 - 23

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).