Stem-loop sequence mdm-MIR164d

AccessionMI0023014 (change log)
DescriptionMalus domestica miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

8 open access papers mention mdm-MIR164d
(39 sentences)

Stem-loop
   -u       u    cc           ca             ----------u   --    c    ac    u 
5'   gggugag agcu  uguuggagaag  gggcacgugcaaa           ucu  agcu aagc  uucc c
     ||||||| ||||  |||||||||||  |||||||||||||           |||  |||| ||||  |||| c
3'   uccacuc uuga  acaaccucuuc  cucgugcacguuu           aga  ucga uucg  aggg c
   ac       u    ac           cc             cgaaacaauuu   au    -    --    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC010871.402: 12521-12655 [-]
intergenic
Database links

Mature sequence mdm-miR164d

Accession MIMAT0025910
Sequence

19 - 

uggagaagcagggcacgugca

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).