Stem-loop sequence mdm-MIR164c

AccessionMI0023013 (change log)
DescriptionMalus domestica miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

8 open access papers mention mdm-MIR164c
(39 sentences)

Stem-loop
          acu   -         a ca             --cccc   g   a   uu 
5' gggugag   ccu uguuggaga g  gggcacgugcaaa      auu gcu ugc  c
   |||||||   ||| ||||||||| |  |||||||||||||      ||| ||| |||  a
3' uccacuc   ggg acaaccucu c  cucgugcacguuu      uaa cga gcg  a
          cuu   c         c cc             yuugaa   g   -   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC022516.233: 9079-9195 [+]
intergenic
Database links

Mature sequence mdm-miR164c

Accession MIMAT0025909
Sequence

17 - 

uggagaagcagggcacgugca

 - 37

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).