Stem-loop sequence mdm-MIR164b

AccessionMI0023012 (change log)
DescriptionMalus domestica miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

8 open access papers mention mdm-MIR164b
(39 sentences)

Stem-loop
          u    c            ca     c       uucuagcuc    aa    u 
5' gggugag aguu guguuggagaag  gggca gugcaaa         gagc  uccu c
   ||||||| |||| ||||||||||||  ||||| |||||||         ||||  |||| a
3' uccacuc ucga cacaaccucuuc  cucgu cacguuu         uucg  agga u
          u    a            cr     u       ---caaaaa    --    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR164b

Accession MIMAT0025908
Sequence

18 - 

uggagaagcagggcacgugca

 - 38

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).