Stem-loop sequence mdm-MIR164a

AccessionMI0023011 (change log)
DescriptionMalus domestica miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

8 open access papers mention mdm-MIR164a
(39 sentences)

Stem-loop
          au   -   u        a c           c    aua    ca 
5' agggaga  gag cca gcuggaga g agggcacaugc agau   ucag  u
   |||||||  ||| ||| |||||||| | ||||||||||| ||||   ||||   
3' ucccucu  cuc ggu cgaccucu c ucucguguacg uuua   aguc  u
          --   a   u        c a           u    -ag    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC019151.253: 7777-7880 [-]
intergenic
Database links

Mature sequence mdm-miR164a

Accession MIMAT0025907
Sequence

19 - 

uggagaagcagggcacaugcc

 - 39

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).