Stem-loop sequence mdm-MIR162a

AccessionMI0023009 (change log)
DescriptionMalus domestica miR162a stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

6 open access papers mention mdm-MIR162a
(19 sentences)

Stem-loop
     a     g    c    c       u       aga     u  ga 
5' gc cugga gcag gguu aucgauc guuuaug   uuugu gu  a
   || ||||| |||| |||| ||||||| |||||||   ||||| ||   
3' cg gaccu cguc ccaa uagcugg uaaguac   agaca ca  a
     c     a    u    a       c       --a     -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC013824.133: 9436-9528 [-]
intergenic
Database links

Mature sequence mdm-miR162a

Accession MIMAT0025905
Sequence

70 - 

ucgauaaaccucugcauccag

 - 90

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).