Stem-loop sequence mdm-MIR160b

AccessionMI0023005 (change log)
DescriptionMalus domestica miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

8 open access papers mention mdm-MIR160b
(38 sentences)

Stem-loop
   u     c       cu         aa    a   u     ugu 
5'  uaugc uggcucc  guaugccac  gcag agu caauc   u
    ||||| |||||||  |||||||||  |||| ||| |||||    
3'  auacg acugagg  uaugcggug  cguu ucg guuag   u
   g     a       ag         gg    a   -     cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC001923.221: 16751-16839 [+]
intergenic
Database links

Mature sequence mdm-miR160b

Accession MIMAT0025901
Sequence

4 - 

ugccuggcucccuguaugcca

 - 24

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).