Stem-loop sequence mdm-MIR159b

AccessionMI0023003 (change log)
DescriptionMalus domestica miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

11 open access papers mention mdm-MIR159b
(68 sentences)

Stem-loop
              ug      a  c       a       -uc     cug  g    u     g u   uc    g      cggura g 
5' ggagcucccuu  auucaa ag aggaggg gagaggg   uuaca   cu cugg ucaug a acc  uggg ugcgca      g a
   |||||||||||  |||||| || ||||||| |||||||   |||||   || |||| ||||| | |||  |||| ||||||      |  
3' ccucgagggaa  uagguu uu uccucuc cucuucc   agugu   ga gacc aguac u ugg  auuu acgcgu      c a
              gu      c  -       -       uua     --a  g    c     g u   ga    g      ------ a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
MDC007814.270: 550-718 [+]
intergenic
Database links

Mature sequence mdm-miR159b

Accession MIMAT0025899
Sequence

150 - 

cuuggauugaagggagcucc

 - 169

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).