Stem-loop sequence mdm-MIR156y

AccessionMI0022995 (change log)
DescriptionMalus domestica miR156y stem-loop
Gene family MIPF0000008; MIR156
Literature search

14 open access papers mention mdm-MIR156y
(298 sentences)

Stem-loop
   u c          -             u  -   a    aagaa 
5'  g ugacagaaga uagagagcacaga ga gga augc     c
    | |||||||||| ||||||||||||| || ||| ||||      
3'  c acugucuucu aucucucguguuu cu ccu uacg     a
   a a          u             c  a   c    acgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mdm-miR156y

Accession MIMAT0025891
Sequence

4 - 

ugacagaagauagagagcac

 - 23

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).