Stem-loop sequence mdm-MIR156i

AccessionMI0022979
DescriptionMalus domestica miR156i stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
            -     g       a  u   au   ruu     cu 
5' ggugacaga agaga ugagcac ca ggu  uuu   gcaug  g
   ||||||||| ||||| ||||||| || |||  |||   |||||  g
3' ccgcugucu ucucu auucgug gu ucg  aag   cguac  g
            a     a       c  u   --   -cu     uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR156i

Accession MIMAT0025875
Sequence

3 - 

ugacagaagagagugagcac

 - 22

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).