Stem-loop sequence mdm-MIR156h

AccessionMI0022978
DescriptionMalus domestica miR156h stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
               -      -       a   ag  ag   uu    aa 
5' guaguugacaga agagag ugagcac cac  gc  caa  guau  a
   |||||||||||| |||||| ||||||| |||  ||  |||  ||||   
3' cgucgacugucu ucucuc acucgug gug  cg  guu  caua  a
               c      c       c   -g  -g   cc    cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR156h

Accession MIMAT0025874
Sequence

6 - 

ugacagaagagagugagcac

 - 25

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).