Stem-loop sequence mdm-MIR156f

AccessionMI0022976
DescriptionMalus domestica miR156f stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   u  c   u   u  uuau    -uu    -----ug              -ug   cu a   ua   a         -    -        a        cu  c    a 
5'  gg gau ggg ag    auua   gugg       aguguuaauuuggu   gga  u ggg  gaa uugacagaa gaga gugagcac cagaggca  ug caua a
    || ||| ||| ||    ||||   ||||       ||||||||||||||   |||  | |||  ||| ||||||||| |||| |||||||| ||||||||  || |||| g
3'  cc cua cuc uc    uaau   uacu       uuauaauuaggccg   ccu  a ccc  cuu gacugucuu cucu uacucgug guuuucgu  ac guau c
   a  c   -   u  -cuu    uuu    uguugaa              uca   uu -   --   c         u    g        c        -u  c    g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (maldom-pseudo1.0) Overlapping transcripts
chr2: 14988066-14988275 [-]
intergenic

Mature sequence mdm-miR156f

Accession MIMAT0025872
Sequence

64 - 

ugacagaagagagugagcac

 - 83

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).