Stem-loop sequence mdm-MIR156e

AccessionMI0022975
DescriptionMalus domestica miR156e stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
          a  -     -        a   ag  gg   uu    aa 
5' aguugac ga agaga gugagcac cac  gc  caa  guau  a
   ||||||| || ||||| |||||||| |||  ||  |||  ||||   
3' ucgacug cu ucucu cacucgug gug  cg  guu  caua  a
          c  c     u        c   -g  -g   uc    cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR156e

Accession MIMAT0025871
Sequence

4 - 

ugacagaagagagugagcac

 - 23

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).