Stem-loop sequence mdm-MIR156d

AccessionMI0022974
DescriptionMalus domestica miR156d stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   u  acuagua   a   -    -        -    -          -   g    uu    aa 
5'  gg       gcg gug gugg ugacagaa gaga gugagcacac ucg gcaa  guau  a
    ||       ||| ||| |||| |||||||| |||| |||||||||| ||| ||||  ||||   
3'  cc       cgc cgc cgcc acugucuu cucu cacucgugug agu cguu  caua  g
   a  cgccycc   -   a    g        u    u          u   g    uc    cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR156d

Accession MIMAT0025870
Sequence

22 - 

ugacagaagagagugagcac

 - 41

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).