Stem-loop sequence mdm-MIR156b

AccessionMI0022972
DescriptionMalus domestica miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   u      -             a  u   acu   uug    cu 
5'  gacaga agagagugagcac ca ggu   uuc   caug  g
    |||||| ||||||||||||| || |||   |||   ||||  g
3'  cugucu ucucucacucgug gu ucg   aag   guac  g
   a      a             c  u   ---   cuy    uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence mdm-miR156b

Accession MIMAT0025868
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).