Stem-loop sequence mmu-mir-7117

AccessionMI0022968 (change log)
Symbol MGI:Mir7117
DescriptionMus musculus miR-7117 stem-loop
Literature search

1 open access papers mention mmu-mir-7117
(1 sentences)

Stem-loop
   ugugau       ---------cu    u ag      c 
5'       cuggggg           cagc g  gauaag c
         |||||||           |||| |  |||||| c
3'       gaccccc           gucg c  cuguuc g
   ------       uuucucuuccu    - ca      c 
Get sequence
Deep sequencing
91 reads, 8 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 27571494-27571558 [+]
sense
OTTMUST00000065060 ; Ank-002; exon 1
OTTMUST00000065059 ; Ank-001; intron 7
ENSMUST00000134004 ; Ank-002; exon 1
ENSMUST00000022875 ; Ank-001; intron 7
Database links

Mature sequence mmu-miR-7117-5p

Accession MIMAT0028131
Sequence

6 - 

ucugggggcucagcugaggaua

 - 27

Get sequence
Deep sequencing75 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7117-3p

Accession MIMAT0028132
Sequence

46 - 

uguccuucucuuucccccag

 - 65

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).