Stem-loop sequence mmu-mir-7115

AccessionMI0022966 (change log)
Symbol MGI:Mir7115
DescriptionMus musculus miR-7115 stem-loop
Literature search

1 open access papers mention mmu-mir-7115
(2 sentences)

Stem-loop
   --  c      u u  ug    au  u  g  u 
5'   gu gggggu g gg  ccga  ug cu ug c
     || |||||| | ||  ||||  || || || a
3'   ca cccccg c cc  gguu  ac ga ac c
   ga  -      u -  cu    -c  c  a  c 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 70438255-70438318 [+]
sense
OTTMUST00000013627 ; Arrb2-012; exon 3
OTTMUST00000013617 ; Arrb2-002; intron 3
OTTMUST00000013616 ; Arrb2-004; exon 4
OTTMUST00000013621 ; Arrb2-006; intron 8
OTTMUST00000040715 ; Arrb2-013; intron 9
OTTMUST00000013620 ; Arrb2-005; intron 9
OTTMUST00000013622 ; Arrb2-007; intron 9
OTTMUST00000013626 ; Arrb2-011; intron 9
OTTMUST00000013619 ; Arrb2-001; intron 9
ENSMUST00000138006 ; Arrb2-012; exon 3
ENSMUST00000143232 ; Arrb2-002; intron 3
ENSMUST00000125441 ; Arrb2-004; exon 4
ENSMUST00000084954 ; Arrb2-006; intron 8
ENSMUST00000108568 ; Arrb2-013; intron 9
ENSMUST00000079056 ; Arrb2-005; intron 9
ENSMUST00000102564 ; Arrb2-007; intron 9
ENSMUST00000128748 ; Arrb2-011; intron 9
ENSMUST00000102563 ; Arrb2-001; intron 9
Database links

Mature sequence mmu-miR-7115-5p

Accession MIMAT0028127
Sequence

2 - 

ucggggguuguggugccgaauugu

 - 25

Get sequence
Deep sequencing24 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7115-3p

Accession MIMAT0028128
Sequence

43 - 

acuugguccccugcccccacag

 - 64

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).