Stem-loop sequence hsa-mir-7111

AccessionMI0022962 (change log)
Symbol HGNC:MIR7111
DescriptionHomo sapiens miR-7111 stem-loop
        -     aaggacaggccaucugcuauucgu 
5' cuggg ggagg                        c
   ||||| |||||                        c
3' gaccc ccucc                        a
        u     cuucucuccuaguucaguccaacc 
Get sequence
Deep sequencing
143 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 35470508-35470579 [+]
OTTHUMT00000355784 ; TULP1-007; intron 2
OTTHUMT00000040308 ; TULP1-004; intron 12
OTTHUMT00000040307 ; TULP1-003; intron 13
ENST00000495781 ; TULP1-007; intron 2
ENST00000322263 ; TULP1-004; intron 12
ENST00000229771 ; TULP1-003; intron 13
Database links

Mature sequence hsa-miR-7111-5p

Accession MIMAT0028119

2 - 


 - 23

Get sequence
Deep sequencing32 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-7111-3p

Accession MIMAT0028120

51 - 


 - 72

Get sequence
Deep sequencing93 reads, 43 experiments
Evidence experimental; meta-analysis [1]
Predicted targets


PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).