Stem-loop sequence mmu-mir-7092

AccessionMI0022942 (change log)
Symbol MGI:Mir7092
DescriptionMus musculus miR-7092 stem-loop
Stem-loop
   ugucua         ucacagaaucauuuucugaa 
5'       aaggcaaac                    a
         |||||||||                     
3'       uuccguuug                    a
   ----ga         uuuuguuucuuguaaaauaa 
Get sequence
Deep sequencing
194 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 74317362-74317429 [+]
sense
OTTMUST00000046869 ; Fam50a-002; intron 3
OTTMUST00000042856 ; Fam50a-001; intron 4
ENSMUST00000138242 ; Fam50a-002; intron 3
ENSMUST00000114160 ; Fam50a-001; intron 4
Database links

Mature sequence mmu-miR-7092-5p

Accession MIMAT0028090
Sequence

6 - 

aaaggcaaacucacagaaucauu

 - 28

Get sequence
Deep sequencing106 reads, 44 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7092-3p

Accession MIMAT0028091
Sequence

45 - 

uguucuuuguuuuguuugccuuag

 - 68

Get sequence
Deep sequencing75 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).