Stem-loop sequence mmu-mir-7091

AccessionMI0022941 (change log)
Symbol MGI:Mir7091
DescriptionMus musculus miR-7091 stem-loop
Literature search

1 open access papers mention mmu-mir-7091
(1 sentences)

Stem-loop
   g     gu      uu    -------g  -      g  gg 
5'  uaggg  gauaga  ccau        gc agaggg au  u
    |||||  ||||||  ||||        || |||||| ||  g
3'  aucuc  cugucu  ggug        cg uuuucc ua  c
   g     ug      uc    acgcagaa  a      g  aa 
Get sequence
Deep sequencing
808 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 74274027-74274105 [-]
sense
OTTMUST00000046874 ; Dnase1l1-008; intron 2
OTTMUST00000046872 ; Dnase1l1-006; intron 2
OTTMUST00000042842 ; Dnase1l1-001; intron 6
OTTMUST00000044079 ; Dnase1l1-002; intron 6
ENSMUST00000114189 ; Dnase1l1-008; intron 2
ENSMUST00000119361 ; Dnase1l1-006; intron 2
ENSMUST00000019232 ; Dnase1l1-001; intron 6
ENSMUST00000075821 ; Dnase1l1-002; intron 6
Database links

Mature sequence mmu-miR-7091-5p

Accession MIMAT0028088
Sequence

1 - 

guaggggugauagauuccauggc

 - 23

Get sequence
Deep sequencing631 reads, 53 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7091-3p

Accession MIMAT0028089
Sequence

59 - 

aguggcuucugucgucucuag

 - 79

Get sequence
Deep sequencing175 reads, 42 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).