Stem-loop sequence mmu-mir-7079

AccessionMI0022929 (change log)
Symbol MGI:Mir7079
DescriptionMus musculus miR-7079 stem-loop
Stem-loop
   ---ccc       u    -   u    --------    u 
5'       ggagggc gagg cag gagu        ccug g
         ||||||| |||| ||| ||||        ||||  
3'       ucucuug cuuc guc cucg        ggac c
   gaccuu       u    a   -    gauguccu    a 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 34 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 123104975-123105043 [+]
sense
OTTMUST00000064647 ; AC114005.5-001; intron 1
OTTMUST00000039780 ; Rpl13-002; exon 3
OTTMUST00000039779 ; Rpl13-001; intron 5
ENSMUST00000127664 ; Gm20388-001; intron 1
ENSMUST00000129311 ; Rpl13-002; exon 3
ENSMUST00000000756 ; Rpl13-001; intron 5
Database links

Mature sequence mmu-miR-7079-5p

Accession MIMAT0028064
Sequence

6 - 

agggcugaggcagugaguccug

 - 27

Get sequence
Deep sequencing76 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7079-3p

Accession MIMAT0028065
Sequence

49 - 

ugacuucuguucucuuuccag

 - 69

Get sequence
Deep sequencing37 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).