Stem-loop sequence mmu-mir-7077

AccessionMI0022927 (change log)
Symbol MGI:Mir7077
DescriptionMus musculus miR-7077 stem-loop
Stem-loop
   uag    a  uc      c   cuauuc 
5'    gcca gg  ccaugg agg      c
      |||| ||  |||||| |||      c
3'    cggu cc  gguacc ucc      u
   -ga    -  uc      u   acacag 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 13 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 117453023-117453079 [+]
sense
ENSMUST00000095172 ; Cmip-201; intron 15
ENSMUST00000166750 ; Cmip-202; intron 15
Clustered miRNAs
< 10kb from mmu-mir-7077
mmu-mir-7077chr8: 117453023-117453079 [+]
mmu-mir-7078chr8: 117459265-117459328 [+]
Database links

Mature sequence mmu-miR-7077-5p

Accession MIMAT0028060
Sequence

3 - 

ggccaaggucccauggcaggc

 - 23

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7077-3p

Accession MIMAT0028061
Sequence

38 - 

ccuuccauggcuccuggcag

 - 57

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).