Stem-loop sequence mmu-mir-7070

AccessionMI0022920 (change log)
Symbol MGI:Mir7070
DescriptionMus musculus miR-7070 stem-loop
Stem-loop
   -- u        cu   g a    gccaagcaggcuaggaggu 
5'   g gaggggag  gag c ggag                   g
     | ||||||||  ||| | ||||                   a
3'   c cucccuuc  cuc g ccuc                   g
   ga -        cu   g a    aaucaauaggaacuccaag 
Get sequence
Deep sequencing
354 reads, 36.9 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 85062086-85062171 [+]
sense
OTTMUST00000077988 ; Fbxw9-001; intron 2
OTTMUST00000077989 ; Fbxw9-002; intron 2
OTTMUST00000077990 ; Fbxw9-003; intron 2
OTTMUST00000077991 ; Fbxw9-004; intron 2
OTTMUST00000077992 ; Fbxw9-005; intron 2
ENSMUST00000095220 ; Fbxw9-001; intron 2
ENSMUST00000139721 ; Fbxw9-002; intron 2
ENSMUST00000145479 ; Fbxw9-003; intron 2
ENSMUST00000152884 ; Fbxw9-004; intron 2
ENSMUST00000142036 ; Fbxw9-005; intron 2
Database links

Mature sequence mmu-miR-7070-5p

Accession MIMAT0028046
Sequence

1 - 

gugaggggagcugaggcagga

 - 21

Get sequence
Deep sequencing238 reads, 51 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7070-3p

Accession MIMAT0028047
Sequence

67 - 

caggcucuccuucccuccag

 - 86

Get sequence
Deep sequencing110 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).