Stem-loop sequence mmu-mir-7064

AccessionMI0022913 (change log)
Symbol MGI:Mir7064
DescriptionMus musculus miR-7064 stem-loop
Stem-loop
   gagguuc             uca      --   guag aa      g 
5'        agaggcauaaagg   uuugcu  uca    u  aggccu g
          |||||||||||||   ||||||  |||    |  ||||||  
3'        ucucuguauuucc   ggacga  ggu    a  uuugga g
   ---gauc             -cg      cu   ---a gg      c 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 143570671-143570759 [-]
sense
OTTMUST00000058712 ; Cars-006; intron 2
OTTMUST00000058708 ; Cars-002; intron 10
OTTMUST00000058707 ; Cars-001; intron 11
ENSMUST00000146904 ; Cars-006; intron 2
ENSMUST00000105909 ; Cars-002; intron 10
ENSMUST00000010899 ; Cars-001; intron 11
Database links

Mature sequence mmu-miR-7064-5p

Accession MIMAT0028032
Sequence

6 - 

ucagaggcauaaaggucauuugcu

 - 29

Get sequence
Deep sequencing22 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7064-3p

Accession MIMAT0028033
Sequence

67 - 

cagggcccuuuaugucucucu

 - 87

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).