Stem-loop sequence mmu-mir-7062

AccessionMI0022911 (change log)
Symbol MGI:Mir7062
DescriptionMus musculus miR-7062 stem-loop
Stem-loop
   uagga   a      cuu u     --    augac 
5'      ugg ggccag   g ggagu  gucu     c
        ||| ||||||   | |||||  ||||      
3'      acc ccgguc   c cuuca  caga     u
   --gac   -      --- u     au    ccaaa 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 139986809-139986874 [-]
sense
OTTMUST00000050400 ; Adam8-003; intron 4
OTTMUST00000050401 ; Adam8-004; intron 13
OTTMUST00000050399 ; Adam8-002; intron 14
OTTMUST00000050398 ; Adam8-001; intron 14
OTTMUST00000050402 ; Adam8-005; intron 14
ENSMUST00000156647 ; Adam8-003; intron 4
ENSMUST00000128332 ; Adam8-004; intron 13
ENSMUST00000026546 ; Adam8-002; intron 14
ENSMUST00000106069 ; Adam8-001; intron 14
ENSMUST00000148670 ; Adam8-005; intron 14
Database links

Mature sequence mmu-miR-7062-5p

Accession MIMAT0028028
Sequence

6 - 

uggaggccagcuuguggagugucu

 - 29

Get sequence
Deep sequencing55 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7062-3p

Accession MIMAT0028029
Sequence

44 - 

acuaacuucuccuggccccacag

 - 66

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).