Stem-loop sequence mmu-mir-7059

AccessionMI0022908 (change log)
Symbol MGI:Mir7059
DescriptionMus musculus miR-7059 stem-loop
Stem-loop
   aaaccacc      -u     uuu    uaa 
5'         ggggac  gcggc   cagu   a
           ||||||  |||||   ||||    
3'         cuccug  ugucg   guca   g
   ----gacc      uu     uuu    cug 
Get sequence
Deep sequencing
1327 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 126579474-126579532 [-]
sense
OTTMUST00000047438 ; Cln3-003; intron 5
OTTMUST00000047449 ; Cln3-014; intron 5
OTTMUST00000047436 ; Cln3-001; intron 6
OTTMUST00000047446 ; Cln3-011; intron 6
OTTMUST00000047439 ; Cln3-004; intron 8
OTTMUST00000047447 ; Cln3-012; intron 8
OTTMUST00000047443 ; Cln3-008; intron 8
OTTMUST00000047437 ; Cln3-002; intron 9
ENSMUST00000098036 ; Cln3-003; intron 5
ENSMUST00000128225 ; Cln3-014; intron 5
ENSMUST00000032962 ; Cln3-001; intron 6
ENSMUST00000125508 ; Cln3-011; intron 6
ENSMUST00000153790 ; Cln3-004; intron 8
ENSMUST00000150917 ; Cln3-012; intron 8
ENSMUST00000128970 ; Cln3-008; intron 8
ENSMUST00000116269 ; Cln3-201; intron 8
ENSMUST00000084589 ; Cln3-002; intron 9
Database links

Mature sequence mmu-miR-7059-5p

Accession MIMAT0028022
Sequence

6 - 

accggggacugcggcuuucagu

 - 27

Get sequence
Deep sequencing1324 reads, 62 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7059-3p

Accession MIMAT0028023
Sequence

38 - 

uguuugcuguuuguccucccag

 - 59

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).