Stem-loop sequence mmu-mir-7052

AccessionMI0022901 (change log)
Symbol MGI:Mir7052
DescriptionMus musculus miR-7052 stem-loop
Stem-loop
   uaucaug        u  a   cuuu     auu 
5'        ugggaagg gg ggc    ccagg   u
          |||||||| || |||    |||||   c
3'        acccuucc cc ccg    gguuc   a
   ------g        u  c   ucuc     caa 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 44470347-44470411 [+]
sense
OTTMUST00000071939 ; Josd2-004; intron 1
OTTMUST00000071950 ; Josd2-015; intron 1
OTTMUST00000071951 ; Josd2-016; exon 1
OTTMUST00000071936 ; Josd2-001; intron 2
OTTMUST00000071937 ; Josd2-002; intron 2
OTTMUST00000071945 ; Josd2-010; intron 2
OTTMUST00000071941 ; Josd2-006; intron 2
OTTMUST00000071946 ; Josd2-011; intron 2
OTTMUST00000071944 ; Josd2-009; intron 3
OTTMUST00000071938 ; Josd2-003; intron 3
OTTMUST00000071947 ; Josd2-012; intron 4
ENSMUST00000121922 ; Josd2-004; intron 1
ENSMUST00000139097 ; Josd2-015; intron 1
ENSMUST00000125363 ; Josd2-016; exon 1
ENSMUST00000035844 ; Josd2-001; intron 2
ENSMUST00000117324 ; Josd2-002; intron 2
ENSMUST00000120852 ; Josd2-010; intron 2
ENSMUST00000118628 ; Josd2-006; intron 2
ENSMUST00000136609 ; Josd2-011; intron 2
ENSMUST00000118493 ; Josd2-009; intron 3
ENSMUST00000133656 ; Josd2-003; intron 3
ENSMUST00000136679 ; Josd2-012; intron 4
Database links

Mature sequence mmu-miR-7052-5p

Accession MIMAT0028008
Sequence

6 - 

ugugggaagguggaggccuuu

 - 26

Get sequence
Deep sequencing44 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7052-3p

Accession MIMAT0028009
Sequence

45 - 

gcucugcccccuccuucccag

 - 65

Get sequence
Deep sequencing33 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).