Stem-loop sequence mmu-mir-7048

AccessionMI0022897 (change log)
Symbol MGI:Mir7048
DescriptionMus musculus miR-7048 stem-loop
Stem-loop
   ggaugc    cu      --u        cg 
5'       gggg  gagagg   gaggaagc  a
         ||||  ||||||   ||||||||  g
3'       cccc  uucucu   cuucuucg  a
   ----ga    -u      uac        au 
Get sequence
Deep sequencing
66 reads, 1.79e+03 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 25217668-25217725 [-]
sense
ENSMUST00000058702 ; Dedd2-201; intron 2
Database links

Mature sequence mmu-miR-7048-5p

Accession MIMAT0028000
Sequence

6 - 

cggggcugagaggugaggaagc

 - 27

Get sequence
Deep sequencing51 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7048-3p

Accession MIMAT0028001
Sequence

38 - 

ucuuccauucucuuuccccag

 - 58

Get sequence
Deep sequencing13 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).