Stem-loop sequence mmu-mir-7038

AccessionMI0022887 (change log)
Symbol MGI:Mir7038
DescriptionMus musculus miR-7038 stem-loop
Literature search

1 open access papers mention mmu-mir-7038
(1 sentences)

Stem-loop
   ugcg   u      a   -  u c    --cu     a 
5'     gug agaagg agg gc g ugug    ugaca g
       ||| |||||| ||| || | ||||    |||||  
3'     cau ucuucc ucc cg c acac    acugu u
   --ga   -      g   u  u -    uuuu     c 
Get sequence
Deep sequencing
265 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 140427339-140427409 [+]
sense
ENSMUST00000100507 ; Eif3b-201; intron 5
Database links

Mature sequence mmu-miR-7038-5p

Accession MIMAT0027980
Sequence

6 - 

uguagaaggaagggcugcugug

 - 27

Get sequence
Deep sequencing256 reads, 43 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7038-3p

Accession MIMAT0027981
Sequence

50 - 

cacugcuccugccuucuuacag

 - 71

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).