Stem-loop sequence mmu-mir-7035

AccessionMI0022884 (change log)
Symbol MGI:Mir7035
DescriptionMus musculus miR-7035 stem-loop
Literature search

1 open access papers mention mmu-mir-7035
(3 sentences)

Stem-loop
   ugaggg  u    g             aga ua   gg   u 
5'       gc ggga aguggcucagaag   g  ccu  cuc g
         || |||| |||||||||||||   |  |||  |||  
3'       cg cccu ucgccgagucuuc   c  gga  gag g
   ----ga  u    g             aga gg   ag   g 
Get sequence
Deep sequencing
118 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 136105522-136105603 [+]
sense
OTTMUST00000062595 ; Rasa4-011; intron 2
OTTMUST00000062550 ; Rasa4-007; intron 15
OTTMUST00000062545 ; Rasa4-002; intron 16
OTTMUST00000062546 ; Rasa4-003; exon 16
OTTMUST00000062547 ; Rasa4-004; intron 16
OTTMUST00000062548 ; Rasa4-005; intron 16
OTTMUST00000062549 ; Rasa4-006; intron 16
OTTMUST00000062544 ; Rasa4-001; intron 17
ENSMUST00000122887 ; Rasa4-011; intron 2
ENSMUST00000140972 ; Rasa4-007; intron 15
ENSMUST00000134509 ; Rasa4-002; intron 16
ENSMUST00000125048 ; Rasa4-003; exon 16
ENSMUST00000135344 ; Rasa4-004; intron 16
ENSMUST00000152723 ; Rasa4-005; intron 16
ENSMUST00000100570 ; Rasa4-006; intron 16
ENSMUST00000042135 ; Rasa4-001; intron 17
Database links

Mature sequence mmu-miR-7035-5p

Accession MIMAT0027974
Sequence

6 - 

ggcugggagaguggcucagaa

 - 26

Get sequence
Deep sequencing39 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7035-3p

Accession MIMAT0027975
Sequence

62 - 

ucugagccgcugucccugcag

 - 82

Get sequence
Deep sequencing48 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).