Stem-loop sequence mmu-mir-7019

AccessionMI0022868 (change log)
Symbol MGI:Mir7019
DescriptionMus musculus miR-7019 stem-loop
Literature search

1 open access papers mention mmu-mir-7019
(2 sentences)

Stem-loop
   aggggau   -        u      a  aca   c ac 
5'        cug ggaggggc gucagg gu   ggc g  u
          ||| |||||||| |||||| ||   ||| |   
3'        gac ucucuccg cgguuc ca   ucg c  g
   -------   g        c      -  --c   c ac 
Get sequence
Deep sequencing
187 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 138316132-138316200 [-]
sense
OTTMUST00000023186 ; Pink1-003; 5'UTR (exon 1)
OTTMUST00000023184 ; Pink1-001; intron 5
OTTMUST00000023185 ; Pink1-002; intron 6
ENSMUST00000105816 ; Pink1-003; 5'UTR (exon 1)
ENSMUST00000030536 ; Pink1-001; intron 5
ENSMUST00000105817 ; Pink1-002; intron 6
Database links

Mature sequence mmu-miR-7019-5p

Accession MIMAT0027942
Sequence

6 - 

aucugggaggggcugucaggagu

 - 28

Get sequence
Deep sequencing46 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7019-3p

Accession MIMAT0027943
Sequence

47 - 

ucaccuuggccgccucucugcag

 - 69

Get sequence
Deep sequencing140 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).