Stem-loop sequence mmu-mir-7004

AccessionMI0022853 (change log)
Symbol MGI:Mir7004
DescriptionMus musculus miR-7004 stem-loop
Stem-loop
   ugaccuuc      u    ccu   -cc  g  u 
5'         cgugga gagg   gug   gu ac c
           |||||| ||||   |||   || || u
3'         gcacuu cucc   cac   ca ug c
   -----gac      c    -cu   cca  g  a 
Get sequence
Deep sequencing
39 reads, 33.3 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 168640696-168640759 [-]
sense
OTTMUST00000038503 ; Atp9a-003; intron 23
OTTMUST00000038502 ; Atp9a-002; intron 23
OTTMUST00000038501 ; Atp9a-001; intron 23
ENSMUST00000109175 ; Atp9a-003; intron 23
ENSMUST00000109176 ; Atp9a-002; intron 23
ENSMUST00000109177 ; Atp9a-001; intron 23
ENSMUST00000029060 ; Atp9a-201; intron 23
ENSMUST00000178504 ; Atp9a-202; intron 23
Database links

Mature sequence mmu-miR-7004-5p

Accession MIMAT0027912
Sequence

6 - 

uuccguggaugaggccugugccgu

 - 29

Get sequence
Deep sequencing19 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7004-3p

Accession MIMAT0027913
Sequence

44 - 

cccacucccuccuucacgcag

 - 64

Get sequence
Deep sequencing17 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).