Stem-loop sequence mmu-mir-6999

AccessionMI0022847 (change log)
Symbol MGI:Mir6999
DescriptionMus musculus miR-6999 stem-loop
Literature search

1 open access papers mention mmu-mir-6999
(1 sentences)

Stem-loop
   ---a         a u    aagca     c 
5'     aggaaggag g cagc     ccugg u
       ||||||||| | ||||     ||||| g
3'     ucuuuccuc c gucg     ggacc g
   gaug         - u    acuuc     c 
Get sequence
Deep sequencing
130 reads, 28.6 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 91944870-91944930 [-]
sense
OTTMUST00000075922 ; Dgkz-013; intron 1
OTTMUST00000033979 ; Dgkz-001; intron 1
OTTMUST00000033980 ; Dgkz-002; intron 1
OTTMUST00000033982 ; Dgkz-004; intron 1
OTTMUST00000034008 ; Dgkz-006; intron 1
OTTMUST00000033981 ; Dgkz-003; intron 2
OTTMUST00000034007 ; Dgkz-005; intron 2
ENSMUST00000099709 ; Dgkz-001; intron 1
ENSMUST00000128152 ; Dgkz-004; intron 1
ENSMUST00000028667 ; Dgkz-002; intron 1
ENSMUST00000142231 ; Dgkz-013; intron 1
ENSMUST00000126473 ; Dgkz-006; intron 1
ENSMUST00000111303 ; Dgkz-003; intron 2
ENSMUST00000142090 ; Dgkz-005; intron 2
Database links

Mature sequence mmu-miR-6999-5p

Accession MIMAT0027900
Sequence

1 - 

aaggaaggagagucagcaagcac

 - 23

Get sequence
Deep sequencing110 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6999-3p

Accession MIMAT0027901
Sequence

38 - 

cuucagcuguccuccuuucugu

 - 59

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).