Stem-loop sequence mmu-mir-6993

AccessionMI0022841 (change log)
Symbol MGI:Mir6993
DescriptionMus musculus miR-6993 stem-loop
Stem-loop
   ggcuca     a      gg   cu   u   cu 
5'       guggg gaaacg  ugu  guc ggu  c
         ||||| ||||||  |||  ||| |||  u
3'       cacuc cuuugu  gcg  cag ucg  g
   ----ga     -      uu   uu   -   uc 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 10191375-10191439 [+]
sense
ENSMUST00000010807 ; Fads1-201; intron 5
Database links

Mature sequence mmu-miR-6993-5p

Accession MIMAT0027888
Sequence

6 - 

agugggagaaacgggugucuguc

 - 28

Get sequence
Deep sequencing56 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6993-3p

Accession MIMAT0027889
Sequence

45 - 

cuugcguuuguuuccucacag

 - 65

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).