Stem-loop sequence mmu-mir-6979

AccessionMI0022827 (change log)
Symbol MGI:Mir6979
DescriptionMus musculus miR-6979 stem-loop
Stem-loop
   -g     g --     g  u    -   u 
5'   gggag c  gcaga ac gagc ugc c
     ||||| |  ||||| || |||| ||| a
3'   cccuc g  ugucu ug uucg gcg g
   ga     g uc     g  -    c   u 
Get sequence
Deep sequencing
70 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 37854605-37854660 [-]
sense
OTTMUST00000049918 ; Diap1-001; intron 22
OTTMUST00000049938 ; Diap1-002; intron 23
OTTMUST00000049939 ; Diap1-003; intron 24
ENSMUST00000080033 ; Diap1-201; intron 21
ENSMUST00000115629 ; Diap1-202; intron 21
ENSMUST00000115634 ; Diap1-001; intron 22
ENSMUST00000025337 ; Diap1-002; intron 23
ENSMUST00000115631 ; Diap1-003; intron 24
Database links

Mature sequence mmu-miR-6979-5p

Accession MIMAT0027860
Sequence

1 - 

ggggaggcgcagagacugag

 - 20

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6979-3p

Accession MIMAT0027861
Sequence

36 - 

uugugucugucuggcucccag

 - 56

Get sequence
Deep sequencing59 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).