Stem-loop sequence mmu-mir-6975

AccessionMI0022823 (change log)
Symbol MGI:Mir6975
DescriptionMus musculus miR-6975 stem-loop
Stem-loop
   agucggcu             uuu    cggu 
5'         ggggagaaagggg   ggca    g
           |||||||||||||   ||||    c
3'         cuccucuuuccuc   cugu    a
   ----gauc             --u    aaaa 
Get sequence
Deep sequencing
86 reads, 2.86 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 35244075-35244135 [+]
sense
OTTMUST00000096125 ; Ddx39b-006; intron 1
OTTMUST00000096122 ; Ddx39b-001; intron 2
OTTMUST00000096123 ; Ddx39b-002; intron 2
OTTMUST00000096124 ; Ddx39b-005; intron 2
OTTMUST00000096127 ; Ddx39b-004; intron 2
ENSMUST00000173731 ; Ddx39b-006; intron 1
ENSMUST00000068056 ; Ddx39b-001; intron 2
ENSMUST00000174757 ; Ddx39b-002; intron 2
ENSMUST00000174164 ; Ddx39b-005; intron 2
ENSMUST00000172549 ; Ddx39b-004; intron 2
Clustered miRNAs
< 10kb from mmu-mir-6975
mmu-mir-6975chr17: 35244075-35244135 [+]
mmu-mir-8094chr17: 35251289-35251405 [+]
Database links

Mature sequence mmu-miR-6975-5p

Accession MIMAT0027852
Sequence

6 - 

gcuggggagaaagggguuuggca

 - 28

Get sequence
Deep sequencing46 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6975-3p

Accession MIMAT0027853
Sequence

42 - 

ucucuccuuucuccuccuag

 - 61

Get sequence
Deep sequencing39 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).