Stem-loop sequence mmu-mir-6973a

AccessionMI0022821 (change log)
Symbol MGI:Mir6973a
DescriptionMus musculus miR-6973a stem-loop
Stem-loop
   ggcucuac      -    g      u   auu  -c  a 
5'         gguggg aggg uggagu gcc   ag  ca a
           |||||| |||| |||||| |||   ||  ||  
3'         ccaucc uccc aucuca cgg   uc  gu u
   -gaccuac      a    a      -   guc  ca  c 
Get sequence
Deep sequencing
222 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 35194972-35195049 [+]
sense
OTTMUST00000095885 ; Ltb-001; intron 1
OTTMUST00000095886 ; Ltb-002; intron 1
OTTMUST00000095887 ; Ltb-003; intron 1
ENSMUST00000025262 ; Ltb-001; intron 1
ENSMUST00000173510 ; Ltb-002; intron 1
ENSMUST00000173600 ; Ltb-003; intron 1
Clustered miRNAs
< 10kb from mmu-mir-6973a
mmu-mir-6973achr17: 35194972-35195049 [+]
mmu-mir-6974chr17: 35204475-35204557 [-]
Database links

Mature sequence mmu-miR-6973a-5p

Accession MIMAT0027848
Sequence

6 - 

uacggugggagggguggaguug

 - 27

Get sequence
Deep sequencing138 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6973a-3p

Accession MIMAT0027849
Sequence

53 - 

cacucuaacccuaccuacccau

 - 74

Get sequence
Deep sequencing80 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).