Stem-loop sequence mmu-mir-6970

AccessionMI0022818 (change log)
Symbol MGI:Mir6970
DescriptionMus musculus miR-6970 stem-loop
Literature search

1 open access papers mention mmu-mir-6970
(2 sentences)

Stem-loop
   gua   u     c    -a  -a      gg  c 
5'    agu caggg uggg  gc  gagacu  gc u
      ||| ||||| ||||  ||  ||||||  ||  
3'    ucg guccc accc  cg  cucugg  cg g
   gac   u     -    ac  ca      ag  u 
Get sequence
Deep sequencing
400 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 34845101-34845167 [-]
sense
OTTMUST00000096098 ; Skiv2l-008; exon 3
OTTMUST00000096097 ; Skiv2l-007; exon 7
OTTMUST00000096092 ; Skiv2l-004; exon 11
OTTMUST00000096089 ; Skiv2l-002; exon 14
OTTMUST00000096090 ; Skiv2l-001; intron 14
OTTMUST00000096091 ; Skiv2l-003; exon 14
ENSMUST00000172686 ; Skiv2l-008; exon 3
ENSMUST00000173403 ; Skiv2l-007; exon 7
ENSMUST00000174363 ; Skiv2l-004; exon 11
ENSMUST00000174226 ; Skiv2l-002; exon 14
ENSMUST00000046022 ; Skiv2l-001; intron 14
ENSMUST00000174887 ; Skiv2l-003; exon 14
Clustered miRNAs
< 10kb from mmu-mir-6970
mmu-mir-6970chr17: 34845101-34845167 [-]
mmu-mir-6971chr17: 34841809-34841871 [-]
Database links

Mature sequence mmu-miR-6970-5p

Accession MIMAT0027842
Sequence

1 - 

guaaguucagggcugggagcagaga

 - 25

Get sequence
Deep sequencing337 reads, 51 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6970-3p

Accession MIMAT0027843
Sequence

44 - 

ucacgccacccacccugugcu

 - 64

Get sequence
Deep sequencing58 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).