Stem-loop sequence mmu-mir-6969

AccessionMI0022817 (change log)
Symbol MGI:Mir6969
DescriptionMus musculus miR-6969 stem-loop
Stem-loop
   guuccca      ua        a   -ua    
5'        gcagag  gggagcaa aga   acc 
          ||||||  |||||||| |||   || a
3'        cgucuc  cccuuguu ucu   uga 
   -----ga      ua        g   cag    
Get sequence
Deep sequencing
352 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 28558441-28558501 [-]
sense
OTTMUST00000059356 ; Clps-002; intron 1
OTTMUST00000059355 ; Clps-001; intron 2
ENSMUST00000114785 ; Clps-002; intron 1
ENSMUST00000025062 ; Clps-001; intron 2
Database links

Mature sequence mmu-miR-6969-5p

Accession MIMAT0027840
Sequence

6 - 

cagcagaguagggagcaaaaga

 - 27

Get sequence
Deep sequencing32 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6969-3p

Accession MIMAT0027841
Sequence

42 - 

uguuguucccaucucugcag

 - 61

Get sequence
Deep sequencing320 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).