Stem-loop sequence mmu-mir-6962

AccessionMI0022809 (change log)
Symbol MGI:Mir6962
DescriptionMus musculus miR-6962 stem-loop
Stem-loop
   cggaaa     cu  -u   -    c   -  u 
5'       aggac  gg  ggg agau uca ca c
         |||||  ||  ||| |||| ||| ||  
3'       uccug  cc  ccc ucua agu gu a
   --gaua     uc  uu   g    u   u  c 
Get sequence
Deep sequencing
218 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 101193869-101193931 [+]
sense
ENSMUST00000000544 ; Acvr1b-201; intron 1
Database links

Mature sequence mmu-miR-6962-5p

Accession MIMAT0027824
Sequence

6 - 

aaggaccuggugggagaucu

 - 25

Get sequence
Deep sequencing201 reads, 48 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6962-3p

Accession MIMAT0027825
Sequence

40 - 

uaucugcccuucccuguccuau

 - 61

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).