Stem-loop sequence mmu-mir-6961

AccessionMI0022808 (change log)
Symbol MGI:Mir6961
DescriptionMus musculus miR-6961 stem-loop
Stem-loop
   aaagcu  - ug        au  c    gcucu 
5'       ga c  ggaaggaa  gg cagg     c
         || |  ||||||||  || ||||     u
3'       cu g  ccuucuuu  cc gucc     a
   ---gau  c gu        cu  u    aauca 
Get sequence
Deep sequencing
198 reads, 2.56 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 100649163-100649229 [-]
sense
OTTMUST00000113375 ; Bin2-003; intron 1
OTTMUST00000114509 ; Bin2-006; intron 2
OTTMUST00000113374 ; Bin2-002; intron 2
OTTMUST00000114510 ; Bin2-007; intron 5
OTTMUST00000114507 ; Bin2-004; intron 7
OTTMUST00000114508 ; Bin2-005; intron 7
OTTMUST00000113348 ; Bin2-001; intron 8
ENSMUST00000183193 ; Bin2-003; intron 1
ENSMUST00000182494 ; Bin2-002; intron 2
ENSMUST00000182068 ; Bin2-006; intron 2
ENSMUST00000182574 ; Bin2-007; intron 5
ENSMUST00000182775 ; Bin2-005; intron 7
ENSMUST00000182814 ; Bin2-004; intron 7
ENSMUST00000183211 ; Bin2-001; intron 8
Database links

Mature sequence mmu-miR-6961-5p

Accession MIMAT0027822
Sequence

6 - 

ugacugggaaggaaauggcc

 - 25

Get sequence
Deep sequencing187 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6961-3p

Accession MIMAT0027823
Sequence

46 - 

uccucuuucuuccuggcucuag

 - 67

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).