Stem-loop sequence mmu-mir-6959

AccessionMI0022806 (change log)
Symbol MGI:Mir6959
DescriptionMus musculus miR-6959 stem-loop
Stem-loop
   gugc      aaccu u     -  u         uucu g 
5'     cuggga     g gucgg gc gugaguguu    g g
       ||||||     | ||||| || |||||||||    |  
3'     gacccu     c cagcc cg cacucauag    c a
   ----      cucgu -     a  u         ---u c 
Get sequence
Deep sequencing
133 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 89305658-89305732 [-]
sense
OTTMUST00000081135 ; Sbf1-006; intron 4
OTTMUST00000081114 ; Sbf1-001; intron 10
OTTMUST00000081116 ; Sbf1-003; intron 10
OTTMUST00000081115 ; Sbf1-002; intron 10
ENSMUST00000147020 ; Sbf1-006; intron 4
ENSMUST00000123791 ; Sbf1-001; intron 10
ENSMUST00000144585 ; Sbf1-003; intron 10
ENSMUST00000124576 ; Sbf1-002; intron 10
Database links

Mature sequence mmu-miR-6959-5p

Accession MIMAT0027818
Sequence

6 - 

ugggaaaccugugucgggcugug

 - 28

Get sequence
Deep sequencing113 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6959-3p

Accession MIMAT0027819
Sequence

54 - 

cugcaccgaccugcucucccag

 - 75

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).