Stem-loop sequence mmu-mir-6958

AccessionMI0022805 (change log)
Symbol MGI:Mir6958
DescriptionMus musculus miR-6958 stem-loop
Literature search

1 open access papers mention mmu-mir-6958
(1 sentences)

Stem-loop
   --    ga -       u    u   u  cccca   cc 
5'   gugg  g aagaggc gcug ggg gc     agu  g
     ||||  | ||||||| |||| ||| ||     |||   
3'   cacu  c uucuccg cgac ucc cg     ucg  c
   ga    ac g       u    -   u  ---ac   au 
Get sequence
Deep sequencing
150 reads, 10.4 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 89185465-89185537 [-]
sense
ENSMUST00000078953 ; Dennd6b-201; intron 17
Database links

Mature sequence mmu-miR-6958-5p

Accession MIMAT0027816
Sequence

1 - 

gugggagaagaggcugcugugg

 - 22

Get sequence
Deep sequencing46 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6958-3p

Accession MIMAT0027817
Sequence

51 - 

ucagcugccucuugccaucacag

 - 73

Get sequence
Deep sequencing102 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).