Stem-loop sequence mmu-mir-6955

AccessionMI0022802 (change log)
Symbol MGI:Mir6955
DescriptionMus musculus miR-6955 stem-loop
Stem-loop
   aaggga    cuc    cu    ag    cc  -aa a 
5'       gggc   agga  cagg  guga  cu   c c
         ||||   ||||  ||||  ||||  ||   | u
3'       cccg   uccu  gucc  cacu  ga   g u
   --gaca    -uu    cu    -a    cu  gag u 
Get sequence
Deep sequencing
442 reads, 2.99 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 78891840-78891913 [+]
sense
ENSMUST00000041587 ; Gga1-201; intron 12
Database links

Mature sequence mmu-miR-6955-5p

Accession MIMAT0027810
Sequence

6 - 

agggccucaggacucaggagguga

 - 29

Get sequence
Deep sequencing429 reads, 61 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6955-3p

Accession MIMAT0027811
Sequence

52 - 

acaccugucuccuuugcccaca

 - 73

Get sequence
Deep sequencing11 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).