Stem-loop sequence mmu-mir-6954

AccessionMI0022801 (change log)
Symbol MGI:Mir6954
DescriptionMus musculus miR-6954 stem-loop
Stem-loop
   uacucu    c  uu    gg    auaug 
5'       gggg ag  cugg  gcag     c
         |||| ||  ||||  ||||     a
3'       cccc uc  gacc  cguc     a
   ---gau    u  uc    ga    cucca 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 76433214-76433273 [+]
sense
OTTMUST00000083383 ; Heatr7a-015; intron 5
OTTMUST00000081368 ; Heatr7a-005; exon 7
OTTMUST00000081366 ; Heatr7a-003; intron 21
OTTMUST00000083372 ; Heatr7a-013; intron 21
OTTMUST00000080943 ; Heatr7a-004; intron 23
OTTMUST00000081367 ; Heatr7a-001; intron 24
ENSMUST00000160631 ; Mroh1-015; intron 5
ENSMUST00000161683 ; Mroh1-005; exon 7
ENSMUST00000160986 ; Mroh1-003; intron 21
ENSMUST00000159218 ; Mroh1-013; intron 21
ENSMUST00000092595 ; Mroh1-201; intron 22
ENSMUST00000161305 ; Mroh1-004; intron 23
ENSMUST00000096385 ; Mroh1-001; intron 24
Database links

Mature sequence mmu-miR-6954-5p

Accession MIMAT0027808
Sequence

6 - 

uggggcaguucugggggcagau

 - 27

Get sequence
Deep sequencing90 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6954-3p

Accession MIMAT0027809
Sequence

40 - 

ugcagccagcucuuccccuag

 - 60

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).