Stem-loop sequence mmu-mir-6951

AccessionMI0022798 (change log)
Symbol MGI:Mir6951
DescriptionMus musculus miR-6951 stem-loop
Stem-loop
   uuucau          -u  uu      ----      gua 
5'       uguauuugug  ga  aaagua    uuagaa   u
         ||||||||||  ||  ||||||    ||||||   u
3'       acauaaacac  cu  uuucgu    agucuu   g
   -----g          uu  uu      uuug      aaa 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 38490473-38490547 [-]
sense
OTTMUST00000060391 ; Azin1-001; intron 11
OTTMUST00000060393 ; Azin1-003; intron 11
OTTMUST00000060414 ; Azin1-005; intron 11
OTTMUST00000060392 ; Azin1-002; intron 12
ENSMUST00000065308 ; Azin1-001; intron 11
ENSMUST00000129589 ; Azin1-003; intron 11
ENSMUST00000110328 ; Azin1-005; intron 11
ENSMUST00000110329 ; Azin1-002; intron 12
Database links

Mature sequence mmu-miR-6951-5p

Accession MIMAT0027802
Sequence

6 - 

uuguauuugugugauuaaagu

 - 26

Get sequence
Deep sequencing61 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6951-3p

Accession MIMAT0027803
Sequence

55 - 

cuuuuuucuucacaaauacag

 - 75

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).